Researchable PM-based history quiz

[sydhe]

Ozbenno is the only contestant so he wins, but he also did awfully well. I'll post the answers in a few days, but I'd like someone to give question 5 a shot since it's such an interesting footnote of history. Just post the answer here; no need for a PM:
5) Who am I?

I was born in luxury to famous parents, but my birth was something of a disappointment. I was orphaned by the time I was 15, while I was imprisoned, and by the time I was 17 all my brothers and sisters were dead. I finally was released to live with my cousin, then went to Lithuania where I met my father's brother. When I was 20 years old, I married my first cousin, the son of yet another of my father's brothers. When I was 35 my elder uncle made good his claim to his inheritance, and when I was 45, so did my other uncle. Finally, when I was 51, I was actually to hold my mother's position for about 20 minutes! I finally died at the age of 72 after a long exile from my homeland.
a) What is my name? 50 pts
b) Who were my parents? 30 pts each
c) Who were my uncles? 30 points each
d) Who was my husband? 50 points
e) What was I for those 20 minutes? 50 points.
f) What events began and ended those 20 minutes. (25 pts each)

I mentioned that her parents are very famous. (She isn't, really, although I've seen her portrayed in movies.) One of the things that made her parents so famous is the way they died, both circumstances and method.

 

[Otkell]

Man...

I found out what the answer of no 5 is 3 days too late

Anyway here it is

It was Mari-Therese-Charlotte, first child of Louis XVI and Marie-Antoinette.

Being the first child of the king after 8 yrs of marriage and not being a male heir to the throne was a disapointment.

Her uncles were Louis XVIII and Charles X.

She married Louis-Antoine, son of Charles.

He was king for twenty minutes in 1830 between the abdication of Charles and his own abdication in favor of his nephew Henri V.

So she was queen of France for 20 minutes.

 

[sydhe]

1) Here are the coats of arms for various places. You are to identify each place.
a)
Tristan de Cunha
b)
Saint Helena. The bird is the St. Helena Plover, which is endemic to the island.
c)
Pitcairn Island
d)
50 points each
Norfolk Island

Ozbenno figured out one was Tristan de Cunha, but guessed the wrong one.

2) UUUUUUUUUUUUUUUUUUUUUUUUUUUUU…UUU
a) What is the above sequence?
It represents a sequence of uracils. UUU is the RNA code for phenylalanine, so the above RNA sequence would produce a protein that is nothing but a sequence of phenylanines.
b) Why is it historically important?
UUU was the first codon of the genetic code to be deciphered (RNA code in this case, not DNA)
c) Who created the sequence?
Marshall Nirenberg and Heinrich Matthaei. Nirenberg got a Nobel prize for this, but Matthaei was left out.

CAGCAGCAGCAGCAGCAGCAGCAG…
d) What is the above sequence?
It is the DNA sequence that codes for a sequence of glutamines.
e) If it looks like this:
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
What happens?
Depends where it occurs, but in general, a long sequence of glutamines in a protein will result in the death of nerve cells, causing one of a variety of nervous disorders. This particular sequence with 39 glutamines is the shortest one which, when it occurs in a certain gene on chromosome 4, will produce Huntington’s chorea.
f) This is associated with a famous singer. Who was he?
Woody Guthrie, who died of Huntington’s chorea at the age of 55

50 point each

3) Now I'm after the name of a composer.
He was born here:
a)
He played here:

He became immensely popular in Europe, the US and Latin America
He died here:

This book was allegedly written about him

Who was he? 100 pts. Who wrote the book? 50 points

Louis Moreau Gottschalk; Ada Clare, his mistress and mother of his son. He was born in New Orleans, played in the French Quarter and died in Rio de Janeiro.

4) A) B)
C) D) E)

a) Who are these five gentlemen (50 pts each)
A) Sully Prudhomme, winner of the 1901 Nobel Prize in Literature
B) Henry Dunant and C) Frédéric Passy, who shared the 1901 Nobel Peace Prize
D) Jacobus van ‘t Hoff, winner of the 1901 Nobel Prize in Chemistry for his work on chemical equilibrium
E) Emil von Behring, winner of the 1901 Nobel Prize in Physiology or Medicine for his discovery of the diphtheria antitoxin.

b) What do they have in common (50 pts) They, together with the answer to c) were the first group of Nobel Laureates.
c) Who is missing? (50 pts) Wilhelm Conrad Röntgen, winner of the 1901 Nobel Prize in Physics for the discovery of X-Rays

5) Who am I? I was born in luxury to famous parents, but my birth was something of a disappointment. I was orphaned by the time I was 15, while I was imprisoned, and by the time I was 17 all my brothers and sisters were dead. I finally was released to live with my cousin, then went to Lithuania where I met my father's brother. When I was 20 years old, I married my first cousin, the son of yet another of my father's brothers. When I was 35 my elder uncle made good his claim to his inheritance, and when I was 45, so did my other uncle. Finally, when I was 51, I was actually to hold my mother's position for about 20 minutes! I finally died at the age of 72 after a long exile from my homeland.
a) What is my name? 50 pts
b) Who were my parents? 30 pts each
c) Who were my uncles? 30 points each
d) Who was my husband? 50 points
e) What was I for those 20 minutes? 50 points.
f) What events began and ended those 20 minutes. (25 pts each)

See Otkell's answer above. Marie-Thérèse-Charlotte is one of those people (Emperor Pu Yi of China's another one) who lived a long and interesting life, and probably wished it was a tad less interesting. It's not everybody who lost their title in TWO French Revolutions.

 

[sydhe]

6) These three men independently made a very famous discovery, only to make another discovery that relegated them to being footnotes.


What are their names, and what was the first discovery and the second?

Hugo de Vries, Carl Correns and Erich von Tschermak-Seysenegg. They independently re-discovered the laws of Mendelian inheritance, then each rediscovered Gregor Mendel’s paper, showing Mendel had been there first.

7)

a) What is the name given to this kind of structure?
Gopuram or Gopura
b) What is the purpose of the structure?
It is the tower at an entrance to a Hindu Temple, found particularly in southern India and Ceylon. Larry Gonick has a spectacular black-and-white sketch of the first one in The Cartoon History of the Modern World, where he calls it the "anti-Taj Mahal."

c) Where is each located?
Madurai, in Tamil Nadu in India
Sri-Mariamman-Temple in Singapore
Srirangam in India, North Tower. This is a different tower than the one shown on Wikipedia.


8) These are a set of British colonial badges from 1914.
a) b)
c) and d)

a) Uganda
b) Mauritius
c) British Somaliland
d) The Union of South Africa.
The one I said was very easy was 8b). Who else would have a dodo on their coat of arms? The bird in a) is a crested crane, and is currently on the flag of Uganda


9) I am a famous saint in my country best known for my military activities. After a disastrous invasion by one major power, I fought off two other major enemies, defeating each in a decisive battle. The three wars took place within a five-year period.
Who am I? Alexander Nevsky
What were the three enemies? The Mongols, the Swedes and the Teutonic Knights
What were the two battles? The Battle of the River Neva and The Battle of the Ice (aka Battle of Lake Peipus)
He didn't beat the Mongols, but did beat the Swedes and Teutonic Knights, who were trying to take advantage of the weakness of the Russian principalities after the Mongol invasion.

10) Capital trivia:
a) Which non-european county has its seat of government in a former Danish fort? What is the current name of the fort?
Ghana. Osu Castle in the city of Accra was formerly known as Fort Christiansborg.
b) Which national capital was once named "The Capital of Willows"? Pyongyang, North Korea
c) Which national capital was founded (under a different name) by a prince on the orders of a seven-headed snake? Vientiane, Laos. The snake was the Naga of Hinduism.
d) Which national capital was founded in 1639. moved from place to place for over a century before it finally reached it's current location?
Fittingly enough, this nomadic capital was Ulaan Bator, Mongolia
e) What is the only Asian capital which does not have traffic lights?
Thimphu, Bhutan. Not because the country tends to be isolated. In this case, the lights were installed and the citizens decided they didn't like them.
f) Which national capital's name literally means something like "muddy join of rivers"? Kuala Lumpur, Malaysia
g) The English name of this capital derives originally from the olive plum trees, but the short form of the native name could be translated as "The city of Los Angeles." Bangkok, Thailand (Krung Thep translates roughly as “City of Angels.&#8221

 

[sydhe]

Ozbenno's up.

 

[Ozbenno]

Firstly, thanks to sydhe, as it was a very enjoyable quiz.

I'll see what I can come up with for the next quiz but will need a couple of weeks I think.

 

[Adler17]

Ozbenno, how far are you?

Adler

 

[Ozbenno]

Its not been a great time but I do have a couple of questions sorted out (its not very easy actually). I will get something sorted soon hopefully.

 

[sydhe]

This time Adler gets to participate and I don't.

 

[Adler17]

Nearly one year ago we had the last quiz. I could make a new one if you are interested. Otherwise I think this kind of quiz is dead. So are you interested?

Adler

 

[Ciceronian]

I was going to suggest someone revive this, but as I was busy with the non-researchable quiz myself I decided against bringing it up, lest I should have to prepare one myself. Thanks Adler, I for one would really appreciate it if you got this going again! How long do you think you will need to prepare one?

 

[Adler17]

If some more are interested I could bring one up within a week. But there should be some more interested. At least 2.

Adler

 

[dutchfire]

I am interested, but I'll most likely fail at all questions

 

[Adler17]

It is the researchable quiz!

Adler

 

[sydhe]

Luceafaruk's still delaying on the cumulative quiz. I'd like to revive this quiz. Anyone interested?

 

[aronnax]

Luceafaruk's still delaying on the cumulative quiz. I'd like to revive this quiz. Anyone interested?

Be our guess...

 

[Olav]

Yeah, bring it on!

I think it's open floor in the cummulative quiz, by the way:

I will now try to have my quiz ready until the end of the month, if not I will hand it over to anybody interested.

That was in October...

 

[Yeekim]

A Messiah to the thread!