Researchable PM-based history quiz

Adler17 said:
Okay, the quiz is over, and we do have a winner:

Luceafarul, 1.300 Pts.

Sydhe got 725 pts and is second.

Congrats, Lichtbringer, your turn.

Adler
Thanks for that my friend, and also for your very nice quiz.
It's a shame really that you didn't get any more participants.
Anyway I look forward to see the answers.
Since I am almost a virgin in making this sort of quiz, I will need a couple of days, but I will try to have a new one up at the end of the week.
 
Adler17 said:
1.


This is an excerpt of a letter from a monarch to another monarch. Who were the monarchs and the empires they ruled? (25 points each) The letter never arrived the addressed person, but was given to someone else. Who and why? (25 pts.) There are 4 threads and insults in this short passage. Find them (25 points each). That's why the ambassador was nearly killed. By whom? (25 pts.) It came to a war in the following time. But how the war was decided? (25 pts.) The people of the winning force introduced another word into the language. What is it? (25 pts.) Such a kind of victory the winning nation had twice more. When? (25 pts. each) At last the looser was visited by a famous man from far away. Who was that? (25 pts.)

300 points

2. Naval Questions:

a) I was built as the first all big gun ship. But due to the lack of what I was not introduced as such? (25 pts.) Indeed another ship was completed then giving this kind of ships the name. What ship? (25 pts.) This was a surprise for all other nations and all except one could not react. What nation could react and reconstruct what class to cope the new thread? (50 pts.)

100 pts.

b) I am called the Last Pirate, although I was a normal officer in my countries navy. Who am I (25 pts.)? However I got this name because of the ship I commanded. What was this ship called and why it was so unusual? (50. pts.). In another war I safed the city I lived in from destruction. What city was it (25 pts.)?

100 pts.

c) I am a Lineij Korabl (right spelling not granted). What is that? (25 pts). What is my name? (25 pts.) I was sunk by German ships in 1917. What ships and what operation it was(50 pts.)?

100 pts.

300 pts.

3. Who are we? (50 pts.)
We were both palaeontologists. Although we were coming from one country, we met in another one while studying palaeontology there. Which country that was? (25 pts.) We became close friends. However we became bitter foes after what happened? (100 pts.) What is this struggle called? (25 pts.) Give a short summary of the events of this struggle! (50 pts.) At last name 2 of the fossils we described each (50 pts.).

300 pts.

4. Who are we? (25 pts.)
The name I am looking for is of Spanish origin and names a general type of people. What is the origin and what kind of people are we? (50 pts.)
However I am looking especially to the ones of a certain island. We were originally brought to that island as slaves. What island and what nation captured us (50 pts.)? However when the island was lost to an enemy nation soon, we were freed and retreated into the hills of the island. When was it? (25 pts.) There we met the last survivors of the original inhabitants. Name the two people (25 pts.). We united to a new people the name I am looking for. In the next years we had two wars with the new owners of the island. When? (50 pts.) But we did not lose these wars. Name our leader of the first war and tell me what special honours the leader got later. (75 pts.)

300 pts.

5. Who am I?
I was born as the prince of a tribe. What tribe this was and who am I? (50 pts.). But due to several circumstances I entered the army of the enemy I hated. I even got the citizenship and a title of this state. What state and title were them? (50 pts.) I was later sent to a new commander in to an uprising. What commander this was and where did this uprising happen (25 pts.)? Later I followed another man, when he became ruler of my country. Who was this? (25 pts.) In this time my country was splitted in numerous tribes. But all hated the enemy. That's why I secretly tried to make an alliance with all tribes I could get. But this was not so secret as it could be. My uncle was envious, as he thought to be the rightful ruler of my tribe, which he wasn't. So he became a traitor. But because of one personal reason the ruler did not believe him, seeing only a family quarrel. What was this reason and who was the traitor? (50 pts.) So I could go on and make a trap. In the following battle we were able to beat the enemy totally. How is this battle called (25 pts.)? One of my allies treached us, so we had to lead a war against him. Who was this? (25 pts.) However my brother stayed in the enemie's army. Who was his name? (25 pts.). Although my pregnant wife was captured later I was able to beat the enemy also in the following campaign. However I was killed shortly afterwars, most likely by my uncle. So it lasted centuries until my dream of a united motherland became true. Who was this king to fulfil that? (25 pts.)

300 pts.

6. Who/ what are we?
a) Quetzacoatl
b) Axolotl
c) Huitzilopochtli
d) Cipactonal
e) Ahuiatl
f) Xochipilli
g) Toci
h) Patecatl
i) Quilatzli
j) Chicomecoatl
k) Calchiuhcihuatl

25 pts. each

One of them is wrong. Which one (25 pts.)?

300 pts.

7. Who said this and what does it mean? (50 pts. each).

a) Timeo Danaos et dona ferentes.
b) Vae victis!
c) Video meliora proboque deteriora sequor.
d) Alea iacta est.
e) Quo vadis?
f) Hic Rhodus, hic salta!

300 pts each.

8. What are they and what is their astronomical counterpart? (50 pts. each)

a) Ceres
b) Mars
c) Phaeton
d) Deimos
e) Eris
f) Theia

300 pts.

2.400 pts. to get. End of Quiz: Monday, 30th October, 9.00 AM CET.

Adler

P.S.: Small error in question #5 deleted.

1.
The monarchs were Kublai Khan of Mongolia and Go Uda of Japan. The letter was given to Kamakura Bakufu, Shogun and de facto ruler of Japan. The threads and insultments are:
a) king of Japan
b) princes of smaller nations
c) master and his servants
d) war will come
The Samurai nearly cut the ambassador in half but were just stopped by the Shogun. The Monglians invaded Japan but their fleet was destroyed by a typhoon. The word is kami kaze (divine wind). Such typhoons happened indeed in 1274, 1281, 1944, 1945, in which 2 invasions completely failed (1274, 1281) resp. had to be delayed (1944, 1945). The visitor was Marco Polo (at least in his claims).

2.

a) The Japanese battleship Satsuma. Due to the lack of guns it wasn't completed as all big gun ship at first, but HMS Dreadnought. This was a surprise for all, and nobody but Germany could alter plans for the next generation of battleships. The Germans modified their plans for the Nassau class.

b) Felix, Graf von Luckner, commander of the sailing ship SMS Seeadler, an auxiliar cruiser in ww1. He also surrendered Halle an der Saale to US troops at the end of ww2.

c) Russian battleship Slava, the only battleship in ww2 to be sunk due to enemy battleships. It was sunk in the Moon sound in 1917 after being damaged by the German dreadnought SMS König. It was the German amphibious landing of the islands of Ösel and Dagö. the only successful naval assault in ww1.

3.

Othniel Charles Marsh and Edward Drinker Cope. Both met each other in Berlin while studying palaeontology in Germany. Rivalry soon darkened their friendship and escalated into hatress at last, when Cope made a mistake, placing the head of the Elasmosaurus on the tail, which Marsh did publish openly (Marsh did the very same with the Apatosaurus). In the following time this esclated to the Bone War. There were thefts, bribes and even shootings among their man to get fossils. Also both tried to defame each other. At the end Cope had no money left for futher expeditions, but he had published 1.400 articles about the fossils he found. Marsh otoh had found more fossils. Cope found 56 dinosaur species while Marsh found 86. Even decades later palaeontologists had to reclassify the species as some were classified several times. So for example Cope, Marsh and a third palaeontologist, Leidy, digged in one are, finding all fossils of the same animal. So it was described as Dinoceras (Marsh), Loxolophodon (Cope) and Uintatherium. The last name it got, as Leidy could prove he was the first to find fossils of the animal.
A few species both had described:

Marsh:
Mosasaurus copeanus
Camarasaurus grandis

Cope:
Camarasaurus leptodirus
Colesteus marshii

(Yes, they honoured each other BEFORE their war!)

4.

Maroons (Spanish Cimmarón), released or fugitive African slaves, who formed with the last Indians (Arawaks, Miskitos) a new people on Jamaica. Jamaica became in 1655 British colony, but before all Spanish slaves were released. They fought two wars to keep their freedom (1720- 1739, 1795). Granny Nanny was the leader of the first war and she is now the only female national hero of Jamaica. Also a town is named after her and the 500 $ bill shows her face.

5.

Arminius or Hermann. He was the son of the Cherusk chieftain Segimur. Arminius became Roman soldier, the Roman citizenship and even an equites (knight). He later fought with Tiberius, the later Emperor of Rome. Later he was assigned to lead the German auxiliar forces in Germany under Quintilius Varus. The traitor was Segestes, whose daugter Tusnelda run away to merry Arminius. That's why Varus did not hear on Segestes supposing a family quarrel. The battle was the battle of the Teutoburg Forest, 9 AD. The Markomannic chieftain Marbod switched the sides and so he was expelled after the Markomans lost the war. Arminius' brother was Flavus. The king uniting all German tribes for the first time was Carolus Magnus.

Answers by Luc:
6. Who/ what are we?
All are deities and creatures from Aztec myhtology:
a)the god of human sustenance, penitent, self-sacrifice, re-birth and butterflies
c)god of war and a sun god
d)god of astrology and the calendar
e)god of fertility
f) god of feasting, painting, dancing, games, and writing
g)grandmother goddess, heart of the earth and mother of the gods. Associated with midwives and war
h)god of medicine
i)goddess of the earth, death, and the milky way.
j)goddess of new maize and produce
k)Maize Goddess
One of them is wrong. Which one?
Except b) which is a salamander

7
a) "I fear the Greeks, even when they bring gifts." Laoocon, priest of Troy, warning the Trojan citizens about accepting the wooden horse during the Trojan War.
b) "Woe to the conquered!" The Gallic chief Brennus demanding more gold from sacked Rome 390 BC
c) "I see and approve of the better things, but I follow the inferior things" Ovid, Roman poet.
d) "The dice has been cast" Julius Caesar on crossing Rubicon 49BC. Actually he probably said it in Greek...
e) "Where are you going?" The apostle Peter asking Christ on the Appian Way.
f) "Here is Rhodes, jump here!" Attributed to Aesop, addressing a man who boasted about having made a huge jump on Rhodes.
8
a) Roman goddess of agriculture - dwarf planet
b) Roman god of war - fourth planet from the Sun
c) Son of the Greek sun god - hypotthetical planet between Mars and Jupiter
(also Asteroid)
d) Son of the Greek gods Ares and Afrodite - the smallest of outermost of Mars' moons
e) Greek goddess of discord - largest known dwarf planet
f) Greek goddess, mother of Helios, Selene and Eios - hypothetical planet involved in the creation of the moon

Adler
 
I am very sorry for all, that I just found a few mistakes in the answers. I am very sorry to lower the points of both.

Luceafarul has now 1.225 points and Sydhe 675. I overlooked the answers again and found the errors. I am very sorry that I overlloked that. However there no harm happened to anyone here.

Adler
 
Sorry Adler, I forgot about it.

:blush:

What's happening? All the usual people are suddenly gone from these quizzes...
 
varwnos said:
Any answer to my question?
Anyway, i think i see why there are so few participants, with such eagerness to reply :mischief:

I haven't a clue. About your question, that is.
 
varwnos, sorry for the late answers, I must have overread them. You can make questions here but only after winning a quiz here (or if it is given free). So you have to participate on a quiz first and then ask your questions.

Adler
 
I apologize in the most humble way for keeping you waiting for such a long time.
Unfortunately I got a nasty laryngitis last week, and didn't exactly feel for any intellectual work. Now I am about to recover, but I will need a few more days before my quiz is up. But stay tuned, good things come to those who are able to display patience.
 
Again, I must offer my most sincere apologies to the community.
I have been busy sorting out some quite important RL issues, and as a consequence of that I was forced to devote my energy and time elsewhere.
Now things looks a bit easier, so in about one week my new quiz should materialize...
 
I am very sorry about this, but due to personal reasons I have to renounce making this quiz, and I leave to anybody interested to step into the limelight.
My most sincere apologies for keeping you waiting all in vain.
 
Okay, I'll try to get a quiz up in the next couple of days.
 
Sorry about the delay. I'm having an attack of iritis which is making it hard to use a computer screen.
 
Again apologies. The iritis was more severe than I realized and I'm still under medication for it. I have several questions ready and I'll post them this week.
 
QUIZ:
Okay, here's the first part of the quiz. The second part will follow in a day or two:

1) Here are the coats of arms for various places. You are to identify each place.
a) b)
c) d)
50 points each

2) UUUUUUUUUUUUUUUUUUUUUUUUUUUUU…UUU
a) What is the above sequence?
b) Why is it historically important?
c) Who created the sequence?

CAGCAGCAGCAGCAGCAGCAGCAG…
d) What is the above sequence?
e) If it looks like this:
CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG
What happens?
f) This is associated with a famous singer. Who was he?
50 point each

3) Now I'm after the name of a composer.
He was born here:
a)
He played here:

He became immensely popular in Europe, the US and Latin America
He died here:

This book was allegedly written about him

Who was he? 100 pts. Who wrote the book? 50 points

4) A) B)
C) D) E)

a) Who are these five gentlemen (50 pts each)
b) What do they have in common (50 pts)
c) Who is missing? (50 pts)

5) Who am I? I was born in luxury to famous parents, but my birth was something of a disappointment. I was orphaned by the time I was 15, while I was imprisoned, and by the time I was 17 all my brothers and sisters were dead. I finally was released to live with my cousin, then went to Lithuania where I met my father's brother. When I was 20 years old, I married my first cousin, the son of yet another of my father's brothers. When I was 35 my elder uncle made good his claim to his inheritance, and when I was 45, so did my other uncle. Finally, when I was 51, I was actually to hold my mother's position for about 20 minutes! I finally died at the age of 72 after a long exile from my homeland.
a) What is my name? 50 pts
b) Who were my parents? 30 pts each
c) Who were my uncles? 30 points each
d) Who was my husband? 50 points
e) What was I for those 20 minutes? 50 points.
f) What events began and ended those 20 minutes. (25 pts each)
 
Top Bottom